Chloroplast genome expansion by intron multiplication in the basal psychrophilic euglenoid Eutreptiella pomquetensis
نویسندگان
چکیده
BACKGROUND Over the last few years multiple studies have been published showing a great diversity in size of chloroplast genomes (cpGenomes), and in the arrangement of gene clusters, in the Euglenales. However, while these genomes provided important insights into the evolution of cpGenomes across the Euglenales and within their genera, only two genomes were analyzed in regard to genomic variability between and within Euglenales and Eutreptiales. To better understand the dynamics of chloroplast genome evolution in early evolving Eutreptiales, this study focused on the cpGenome of Eutreptiella pomquetensis, and the spread and peculiarities of introns. METHODS The Etl. pomquetensis cpGenome was sequenced, annotated and afterwards examined in structure, size, gene order and intron content. These features were compared with other euglenoid cpGenomes as well as those of prasinophyte green algae, including Pyramimonas parkeae. RESULTS AND DISCUSSION With about 130,561 bp the chloroplast genome of Etl. pomquetensis, a basal taxon in the phototrophic euglenoids, was considerably larger than the two other Eutreptiales cpGenomes sequenced so far. Although the detected quadripartite structure resembled most green algae and plant chloroplast genomes, the gene content of the single copy regions in Etl. pomquetensis was completely different from those observed in green algae and plants. The gene composition of Etl. pomquetensis was extensively changed and turned out to be almost identical to other Eutreptiales and Euglenales, and not to P. parkeae. Furthermore, the cpGenome of Etl. pomquetensis was unexpectedly permeated by a high number of introns, which led to a substantially larger genome. The 51 identified introns of Etl. pomquetensis showed two major unique features: (i) more than half of the introns displayed a high level of pairwise identities; (ii) no group III introns could be identified in the protein coding genes. These findings support the hypothesis that group III introns are degenerated group II introns and evolved later.
منابع مشابه
A horizontally acquired group II intron in the chloroplast psbA gene of a psychrophilic Chlamydomonas: in vitro self-splicing and genetic evidence for maturase activity.
The majority of known group II introns are from chloroplast genomes, yet the first self-splicing group II intron from a chloroplast gene was reported only recently, from the psbA gene of the euglenoid, Euglena myxocylindracea. Herein, we describe a large (2.6-kb) group II intron from the psbA gene (psbA1) of a psychrophilic Chlamydomonas sp. from Antarctica that self-splices accurately in vitro...
متن کاملLoss of Chloroplast trnLUAA Intron in Two Species of Hedysarum (Fabaceae): Evolutionary Implications
Previous studies have indicated that in all land plants examined to date, the chloroplast gene trnLUAA isinterrupted by a single group I intron ranging from 250 to over 1400 bp. The parasitic Epifagus virginiana haslost, however, the entire gene. We report that the intron is missing from the chloroplast genome of twoarctic species of the legume genus Hedysarum (H. alpinum, H. ...
متن کاملEvolution of the chloroplast genome in photosynthetic euglenoids: a comparison of Eutreptia viridis and Euglena gracilis (Euglenophyta).
The chloroplast genome of Eutreptia viridis Perty, a basal taxon in the photosynthetic euglenoid lineage, was sequenced and compared with that of Euglena gracilis Ehrenberg, a crown species. Several common gene clusters were identified and gene order, conservation, and sequence similarity was assessed through comparisons with Euglena gracilis. Significant gene rearrangements were present betwee...
متن کاملIdentification and comparative analysis of the chloroplast alpha-subunit gene of DNA-dependent RNA polymerase from seven Euglena species.
When the sequence of the Euglena gracilis chloroplast genome was reported in 1993 the alpha-subunit gene (rpoA) of RNA polymerase appeared to be missing, based on a comparison of all putative reading frames to the then known rpoA loci. Since there has been a large increase in known rpoA sequences, the question of a Euglena chloroplast rpoA gene was re-examined. A previously described unknown re...
متن کاملTranscriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.
Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp...
متن کامل